polyclonal rabbit anti zo 2 antibody no 71 1400 (Thermo Fisher)
Thermo Fisher is a verified supplier 
Thermo Fisher manufactures this product 
86
Structured Review
Thermo Fisher
polyclonal rabbit anti zo 2 antibody no 71 1400
Polyclonal Rabbit Anti Zo 2 Antibody No 71 1400, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/polyclonal+rabbit+anti+zo+2+antibody+no+71+1400/pmc03503771-15-10-16
Average 86 stars, based on 1 article reviews
Polyclonal Rabbit Anti Zo 2 Antibody No 71 1400, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/polyclonal+rabbit+anti+zo+2+antibody+no+71+1400/pmc03503771-15-10-16
Average 86 stars, based on 1 article reviews
polyclonal rabbit anti zo 2 antibody no 71 1400 - by Bioz Stars,
2026-10
86/100 stars
Images
1) Product Images from "Role of tight junction proteins in gastroesophageal reflux disease"
Article Title: Role of tight junction proteins in gastroesophageal reflux disease
Journal: BMC Gastroenterology
doi: 10.1186/1471-230X-12-128
Figure Legend Snippet: Characteristics of primers, RT-PCR protocol and antibodies
Techniques Used: Sequencing
Related Articles
Sequencing:Article Title: Role of tight junction proteins in gastroesophageal reflux disease Article Snippet: ZO-2 , fw: AGAGGACACGCCGAGCAGATTG rv: TCCCGACATCATTGCCACCAG 272 bp, 60°C , |