Review



polyclonal rabbit anti zo 2 antibody no 71 1400  (Thermo Fisher)


Bioz Verified Symbol Thermo Fisher is a verified supplier
Bioz Manufacturer Symbol Thermo Fisher manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
    • 86
      Buy from Supplier

    Structured Review

    Thermo Fisher polyclonal rabbit anti zo 2 antibody no 71 1400
    Characteristics of primers, RT-PCR protocol and antibodies
    Polyclonal Rabbit Anti Zo 2 Antibody No 71 1400, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/polyclonal rabbit anti zo 2 antibody no 71 1400/product/Thermo Fisher
    Average 86 stars, based on 1 article reviews
    polyclonal rabbit anti zo 2 antibody no 71 1400 - by Bioz Stars, 2026-03
    86/100 stars

    Images

    1) Product Images from "Role of tight junction proteins in gastroesophageal reflux disease"

    Article Title: Role of tight junction proteins in gastroesophageal reflux disease

    Journal: BMC Gastroenterology

    doi: 10.1186/1471-230X-12-128

    Characteristics of primers, RT-PCR protocol and antibodies
    Figure Legend Snippet: Characteristics of primers, RT-PCR protocol and antibodies

    Techniques Used: Sequencing



    Similar Products

    polyclonal rabbit anti zo 2 antibody no 71 1400  (Thermo Fisher)
    86
    Thermo Fisher polyclonal rabbit anti zo 2 antibody no 71 1400
    Characteristics of primers, RT-PCR protocol and antibodies
    Polyclonal Rabbit Anti Zo 2 Antibody No 71 1400, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/polyclonal rabbit anti zo 2 antibody no 71 1400/product/Thermo Fisher
    Average 86 stars, based on 1 article reviews
    polyclonal rabbit anti zo 2 antibody no 71 1400 - by Bioz Stars, 2026-03
    86/100 stars
    		  Buy from Supplier
    rabbit polyclonal anti–zo-2 71-1400  (Thermo Fisher)
    90
    Thermo Fisher rabbit polyclonal anti–zo-2 71-1400
    Characteristics of primers, RT-PCR protocol and antibodies
    Rabbit Polyclonal Anti–Zo 2 71 1400, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/rabbit polyclonal anti–zo-2 71-1400/product/Thermo Fisher
    Average 90 stars, based on 1 article reviews
    rabbit polyclonal anti–zo-2 71-1400 - by Bioz Stars, 2026-03
    90/100 stars
    		  Buy from Supplier

    Image Search Results


    Characteristics of primers, RT-PCR protocol and antibodies

    Journal: BMC Gastroenterology

    Article Title: Role of tight junction proteins in gastroesophageal reflux disease

    doi: 10.1186/1471-230X-12-128

    Figure Lengend Snippet: Characteristics of primers, RT-PCR protocol and antibodies

    Article Snippet: ZO-2 , fw: AGAGGACACGCCGAGCAGATTG rv: TCCCGACATCATTGCCACCAG 272 bp, 60°C , polyclonal rabbit anti-ZO-2 antibody No. 71–1400, (Invitrogen, Carlsbad, CA, USA, EDTA retrieval, Final dilution: 1:150.

    Techniques: Sequencing